Гепатит с на гемодиализе

Гепатит с на гемодиализе

Evidence of association between hepatitis C virus genotype 2b and nosocomial transmissions in hemodialysis centers from southern Brazil
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3680315/

Инфекция вируса гепатита С является серьезной проблемой общественного здравоохранения. Гемодиализ считается одним из основных факторов риска инфицирования ВГС, из-за нескольких инвазивных медицинских процедур и возможной нозокомиальной передачи, которые постоянно подаются пациентам с хронической почечной недостаточностью (ОФД). Целью этого исследования было определить распространенность HCV и его генотипов у пациентов с ХПН в подразделениях гемодиализа на юге Бразилии.

Были собраны и проанализированы демографические данные и факторы риска передачи ВГС. Эти данные были получены у пациентов, проходящих лечение гемодиализом с января 2009 года по август 2010 года, на двух диализных отделениях Рио-Гранде, на юге Бразилии. Генотипирование проводили путем анализа последовательности HCV NS5b, ядро-E1 и 5’UTR геномных областей.

Изучали сто пятьдесят девять пациентов при регулярном лечении гемодиализом. Распространенность ВГС составила 23,3%. Пациенты с HCV-инфекцией находились на диализном лечении в течение 91,9 месяца, что более длительное время было по сравнению с HCV-негативными пациентами (p = 0,001). Хотя генотипы HCV 1b и 3a были идентифицированы как наиболее частые штаммы, удивительно высокая доля генотипа 2b наблюдалась среди пациентов в одном из центров диализа по сравнению с общей популяцией HCV-инфицированных в той же области. Время воздействия на лечение гемодиализа и работа в области здравоохранения были связаны с инфекцией HCV.

Помимо усилий по минимизации внутрибольничной передачи HCV, некоторые события передачи все еще проявляются в диализных отделениях.

Примерно 170 миллионов человек во всем мире инфицированы вирусом гепатита C (HCV) и подвержены риску развития хронического гепатита, цирроза и гепатоцеллюлярной карциномы [1,2]. Более того, HCV-инфекция является наиболее распространенным показателем для трансплантации печени в развитых странах [3].

В Бразилии средний уровень распространенности гепатита С составляет от 2,5% до 10% [4]. В последнее время общенациональное и комплексное обследование населения с популяцией сообщило о скорости серопозитивности HCV 1,38% [5]. Тем не менее, в южном регионе страны положительные подтвержденные положительные результаты HCV выше, чем в среднем по стране (9,4 против 5,4 на 100 000 субъектов в 2011 году, соответственно) [6].

Гемодиализ считается одним из основных факторов риска заражения ВГС из-за многочисленных процедур доступа к сосудам, периодических переливаний крови и потенциальной внутрибольничной передачи, которым постоянно подвергаются пациенты с хронической почечной недостаточностью (ОФД) [1,7]. Несмотря на эффективный контроль и безопасные медицинские практики, направленные на снижение риска передачи инфекционных заболеваний среди пациентов с гемодиализом, спорадические вспышки в диализных отделениях все еще происходят. Основные процедуры профилактики внутрибольничной передачи HCV включают протоколы для обращения с физическими жидкостями, политики изоляции и использования эритропоэтина для минимизации переливания крови [7,8]. Некоторые факторы, такие как переливание крови и продолжительность лечения гемодиализом, особенно связаны с более высокой смертностью среди этих пациентов [9-13].

Инфекция HCV варьируется в зависимости от характеристик пациента, географического положения, социально-экономических аспектов, количества пациентов на диализатор и строгого использования строжайших стандартов биобезопасности [14,15]. Различия в поведении пациентов и факторах риска для сообщества могут также способствовать более высокой распространенности ВГС в единицах гемодиализа [15]. Распространенность HCV среди бразильских пациентов с гемодиализом колеблется от 11% до 90%, но характеристика генотипа HCV недостаточно хорошо документирована [16-21]. Наиболее распространенным является генотип HCV 1a, за которым следуют 1b и 3a [21-25], за исключением исследования, проведенного Busek и его коллегами [20], которые обнаружили второй тип генотипа 2b.

У пациентов с хронической почечной недостаточностью есть особенности, которые ухудшают диагностику HCV. Небольшое увеличение уровня аминотрансфераз, прерывистая виремия и отрицательная анти-HCV серология в течение длительного периода после заражения являются характеристиками, обычно наблюдаемыми в этой популяции [7,19]. Обнаружение РНК HCV методом RT-PCR является лучшим методом диагностики HCV-инфекции у пациентов с CRF [26,27], несмотря на периодическую виремию, описанную у 33% -67% пациентов с положительным анти-HCV [7].

Целью этого исследования было определить распространенность HCV и его генотипов у пациентов с ХПН в двух центрах гемодиализа в Рио-Гранде, на юге Бразилии, и основных факторов риска, связанных с инфекцией в этой группе пациентов.

Проанализированная популяция составляла 57,2% мужчин, средний возраст составил 56,9 года (SD ± 15,9), а 65,4% были кавказцами. Что касается образования, 66,7% были неграмотными или не окончили начальную школу. Основным сообщенным рискованным поведением для ВГС были переливание крови (94,3%) и хирургические процедуры (90%). Приблизительно 2% пациентов сообщили о гемофилии, 2% были потребителями инъекционных наркотиков (ПИН), 3% общих шприцев или игл и 2% информированного использования ингаляционного кокаина.

Распространенность HCV в анализируемых единицах диализа составляла 23,3% (37/159). Средний возраст пациентов с ВГС-положительными составил 54,9 года (SD ± 13,3), а 62,2% — мужчины. Статистическая модель инфекции HCV была скорректирована с учетом возраста. В таблице 1 показаны сырые и скорректированные ОР для HCV-инфекции в соответствии с факторами риска HCV. Как отмечалось, многомерный анализ показал значительный PR для работников здравоохранения 4,26 (p = 0,048).

Сырой (cPR) и скорректированный (aPR) показатель распространенности инфекции HCV в соответствии с факторами риска (n = 159)

Среднее время гемодиализа среди всех пациентов, включенных в это исследование, составляло 55,1 месяца (SD ± 58). В отличие от этого, пациенты с положительным гепатитом С были на диализном лечении в течение 92 месяцев (SD ± 82), период времени значительно выше по сравнению с HCV-отрицательными пациентами (44 ± 43 месяца, p = 0,001). В многовариантном анализе, представленном в Таблице 1, эта переменная также показала пограничное значение (р = 0,09) независимо от HCV-инфекции. В то время как до- и постдиализный уровень мочевины, калия, кальция и фосфора не отличался между HCV-отрицательными и положительными пациентами (данные не показаны), средняя сывороточная аланинаминотрансфераза (ALT) была значительно выше среди инфицированных пациентов (17,1 против 27,6 МЕ / L; p = 0,003), ожидаемый результат.

Все серологические результаты были подтверждены обнаружением РНК HCV с последующей ПЦР NS5b или 5’UTR (таблица 2). Генотипирование HCV проводилось у 31 (84%) инфицированных пациентов на основе филогенетического анализа последовательностей NS5b. В шести случаях подтипирование HCV не было возможным из-за отрицательных результатов ПЦР для этой вирусной геномной области. Они включали четыре штамма генотипа 1, один генотип 2 и один генотип 3. В целом были определены 33 5’UTR и 31 NS5b последовательности. Для изолятов, для которых были доступны как NS5b, так и 5’UTR-последовательности, оба региона выявили один и тот же генотип во всех случаях. Согласно анализу области NS5b, 14 принадлежали к генотипу 1; четыре были подтипами 1а (13%) и 10 были подтипом 1b (32,5%). Все изоляты генотипа 2 (n = 7) относятся к подтипу 2b с преобладанием 22%. Генотип HCV 3 (подтип 3a) также присутствовал у 10 испытуемых (32,5%). Все генотипические классификации были дополнительно подтверждены секвенированием HCV 5’UTR (данные не показаны). Единственный дополнительный изотоп генотипа 2b был обнаружен в блоке 1, для которого был доступен только геномный регион 5’UTR. На фигуре 1А показаны все фрагменты HC5 NS5b, филогенетически анализируемые. Из дерева видно, что все изоляты генотипа 2b, охарактеризованные в этой работе (все из Единицы 2), сгруппированы вместе, хотя была достигнута лишь довольно значительная ценность бутстрапа (70%). Этот кластер не наблюдается для остальных обнаруженных генотипов (рис. 1А), для которых последовательности чередуются с базовыми последовательностями базы данных. Однако некоторые подтипы 1a и 1b последовательно анализируются, и общий источник передачи в этих случаях не может быть полностью исключен.

Распределение подтипов HCV у пациентов с гемодиализом в соответствии с филогенетическим анализом геномных областей 5’UTR и NS5b

* Для генотипа 1 5’UTR не различает подтипы, а числа объединяются.

Филогенетическое дерево, изображающее HCV NS5b (A) или геномную область ядра E1 (B) анализируемых изолятов. Изоляты HCV, охарактеризованные в исследовании, выделяются символами (круг, подтип 1b, квадрат, подтип 1a, бриллианты, подтип 2b, треугольники, подтип 3a). Показаны только значения поддержки бутстрапа выше 80%, которые дифференцируют основные генотипы и подтипы HCV. Дерево было укоренено с подтипом 7a последовательности, вариант не найден в Бразилии. Бары под деревьями представляют собой генетическое расстояние 5% на уровне нуклеотидов.

Чтобы подтвердить существование трансмиссионного кластера, несущего последовательности подтипов HCV 2b в блоке 2, был проведен филогенетический анализ другой геномной области HCV (граница ядра-E1). Полу-вложенная ПЦР этого региона была предпринята попытка для пяти из семи вирусов HCV-2b, наблюдаемых в Единице 1, и из этих четырех последовательностей E1 были сгенерированы. Как показано на рисунке 1B, четыре последовательности по-прежнему группируются вместе со значением начальной загрузки 80%, дополнительно выделяя кластер передачи, наблюдаемый с последовательностями NS5b.

Это первое исследование, характеризующее распространенность генотипов HCV среди пациентов, проходящих гемодиализ в южной части Бразилии. Была обнаружена более высокая распространенность генотипа 2b, генотип с редким появлением в Бразилии, что указывает на возможное событие нозокомиальной передачи в одном из двух изученных здесь гемодиализных единиц. Нозокомиальная передача по-прежнему является общим событием в диализных отделениях, и надлежащее выявление инфекции HCV среди этих пациентов остается проблемой.

Показатель распространенности HCV, обнаруженный в этом исследовании (23,3%), был выше по сравнению с предыдущими исследованиями в общей популяции в том же регионе, что свидетельствует о распространенности от 6% до 8,6% [28]. С другой стороны, когда исследования, проведенные с пациентами по гемодиализу, рассматриваются, распространенность ВГС с 14,6% до 46,7% отмечается в разных городах Бразилии [16,17,19,20]. Это несоответствие в значительной степени подчеркивает HCV как серьезную заболеваемость в единицах гемодиализа, ставя под угрозу безопасность пациентов с ХПН.

В этом исследовании время лечения гемодиализа и занятость в области здравоохранения были значительно связаны с инфекцией HCV, причем большинство из них наблюдалось у пожилых людей и мужчин. Мейерс и его коллеги [29] также обнаружили связь инфекции HCV со временем лечения гемодиализом.

Сообщалось о нескольких географических и этнических различиях в распространенности генотипов HCV, а также о временных, поведенческих и культурных различиях [30,31]. В то время как в Бразилии генотипы HCV 1 и 3 преобладают, в некоторых странах Латинской Америки, таких как Аргентина и Венесуэла, преобладают генотипы 1 и 2, ответив примерно на 90% случаев [32]. В Европе наблюдается непрерывное снижение генотипа 3 и зарегистрировано увеличение генотипа 2 [33,34]. Распределение генотипов HCV в этом исследовании было аналогично тому, как это было описано другими авторами для одного и того же географического региона, причем генотипы 1 и 3 HCV отвечают за большинство инфекций [35-37]. Сообщается, что генотип 3a особенно распространен в южной части Бразилии [36,38]. Примечательно, однако, высокая распространенность генотипа 2b среди пациентов, лечившихся в единицах гемодиализа, зарегистрированных здесь, особенно из одного из изученных единиц. Это уникальная характеристика, учитывая низкую распространенность этого генотипа в Бразилии [15,21,33,39,40]. Эти данные свидетельствуют о потенциальной роли нозокомиальной передачи среди вовлеченных пациентов.

Гепатит С является наиболее распространенной причиной хронической вирусной болезни печени у пациентов с гемодиализом [17]. Среди этих пациентов было выявлено несколько факторов риска заражения HCV, включая хирургическое вмешательство и частые переливания крови, которым они подвергаются. Кроме того, нозокомиальная передача в единицах диализа может быть связана с процедурами гемодиализа, такими как образование аэрозолей во время канюлирования свищей для доступа к венам, несчастные случаи с зараженной кровью и прямой контакт с зараженными материалами, используемыми инфицированными пациентами [41].

Наша гипотеза о внутрибольничной передаче генотипа ВГС 2 также подтверждается филогенетическим анализом охарактеризованных изолятов. Все последовательности подтипов 2b сгруппированы вместе для анализа двух различных геномных областей HCV, что указывает на общий источник инфекции. Эта функция не была замечена для других изученных генотипов, где базовые последовательности баз данных смешались с последовательностями запросов, за исключением нескольких потенциальных линий передачи внутри подтипов. С другой стороны, вполне вероятно, что подтип 2b циркулирует в Бразилии как монофилетическая линия, основанная на недавних общенациональных анализах последовательности HCV (Lampe et al., Antivir Ther in press). Поэтому мы не можем исключить возможность того, что рассматриваемый здесь кластер подтипов 2b отражает такое единственное введение этого подтипа в стране, а не блафайдское внутрисетевое распространение. Однако эпидемиологические данные о частоте этого подтипа в Бразилии в значительной степени утверждают в пользу гипотезы о нозокомиальной передаче. Однако это вероятный сценарий в анализируемой обстановке, нельзя полностью исключить дополнительную возможность того, что генетический фон этого варианта облегчает его парентеральную передачу. Парабони и его коллеги [26] обнаружили ассоциацию генотипа HCV 2b с зубными процедурами на юге Бразилии. К этому фактору можно отнести и другие аспекты, связанные с пациентами с ХПН, для объяснения более высокой распространенности генотипа 2b и его облегченной передачи среди медицинских или стоматологических вмешательств. Наконец, хотя генотип 2b не является распространенным вариантом в Бразилии, он является очень распространенным генотипом в соседних странах его южных границ, таких как Аргентина, с которыми Бразилия имеет интенсивное переселение населения. Такой сценарий также может способствовать более высокой распространенности генотипа 2b в этой области.

В Бразильской системе общественного здравоохранения установлены руководящие принципы предотвращения распространения ВГС в диализных отделениях [42]. Эти действия включали строгое выполнение универсальных мер предосторожности и процедур биобезопасности, скрининг на анти-HCV среди пациентов, стерилизацию диализных машин и все используемые инструменты и обучение медицинских работников. Еще одна важная мера заключается в выделении пациентов с положительной серологией для борьбы с ВГС, даже во время их транспортировки или переноса, из-за риска сосудистого кровотечения из-за гепаринизации во время диализа [2,15,43]. В соответствии с этим сценарием важно знать серологический статус всех пациентов в подразделении, чтобы меры могли быть успешно реализованы. Трудности при диагностике инфекции HCV у пациентов с ХПН составляют основное ограничение против попыток избежать внутрибольничной передачи на диализных отделениях. Из-за поздней сероконверсии у этих пациентов только серологическое тестирование является неубедительным для скрининга на ВГС, что приводит к ложным отрицательным результатам [19,26,44,45].

В заключение было подробно обсуждено, что пациенты с гемодиализом подвергаются высокому риску заражения HCV. Помимо усилий по минимизации или устранению нозокомиальной передачи ВГС, некоторые события все еще можно обнаружить в разных диализных единицах. Важно рассмотреть измерение РНК HCV у этих пациентов, поскольку иммуносупрессия, присущая хроническому заболеванию почек, является профилактическим фактором против внутрибольничного распространения HCV.

Это было проспективное исследование, разработанное среди пациентов, которым проводилось лечение гемодиализом с января 2009 года по август 2010 года, а затем в двух отделениях диализа, расположенных в городе Рио-Гранде, на юге Бразилии. В этом опросе было включено сто пятьдесят девять пациентов, 116 из 1-го и 43-го от 2-го блока. Исследование проводилось с одобрения местного комитета по этике Федерального университета Рио-Гранде (номер 7222741/2008). Письменное информированное согласие было получено от всех пациентов, а критерии приемлемости включали возраст старше 17 лет и согласие на стандартизованный вопросник, содержащий социально-демографические переменные, а также информацию о рискованных поведениях и методах, связанных с приобретением HCV.

Серология HCV, уровни аланинаминотрансферазы и другие биохимические переменные проводились на диализных установках. Оба блока проводили скрининг HCV на своих пациентах периодически, ежеквартально, с помощью ELISA против HCV третьего поколения (Imuno-Elisa Anti-HCV, Wamma Diagnostica, Сан-Паулу, Бразилия). Во время серологического скрининга один дополнительный образец из 5 мл цельной крови собирали в пробирку с этилендиаминтетрауксусной кислотой у каждого пациента, включенного в исследование. Плазму отделяли и отправляли в лабораторию молекулярной биологии Университета Федерал Рио-Гранде (FURG) и хранили при -80 ° C. HCV-положительные образцы (n = 37) оттаивали и анализировали на обнаружение и генотипирование РНК ВГС.

Вирусную РНК экстрагировали из 140 мкл плазмы комплексом экстракции вирусной РНК QIAamp (Qiagen, Chatsworth, США). Конечный объем 60 мкл вирусной РНК смешивали с 600 нг случайных праймеров (Life Technologies, Carlsbad, США) в воде, обработанной диэтилпирокарбонатом, и инкубировали в течение 10 мин при 70 ° С. Обратную транскрипцию проводили с 200 U обратной транскриптазой вируса молочной мыши (Life Technologies, Carlsbad, USA), 0,1 моль / л DTT, 25 U RNaseOUT (Life Technologies) и 0,5 ммоль / л каждого дезоксинуклеотида в течение 90 минут при 37 ° С. Был проведен анализ полуположенной полимеразной цепной реакции (ПЦР) с праймерами Pr3 (5′-TATGAYACCCGCTGYTTTGACTC-3 ‘, внешний фон), Pr4 (5′-GCNGARTAYCTVGTCATAGCCTC-3′, внутренним фоном) и Pr5 (5’-GCTAGTCATAGCCTCCGT -3 ‘, реверс) для амплификации продукта 380 п.о., соответствующего внутренней области гена HC5 NS5b [46]. Дополнительные вложенные ПЦР-анализы проводили с праймерами PTC1 (5’CGTTAGTATGAGTGTCGTGC3) и NCR2 (5’ATACTCGAGGTGCACGGTCTACGAGACCT3) в первом раунде и с PTC3 (5’GTGTCGTGCAGCCTCCAGG3 ‘) и NCR4 (5’CACTCTCGAGCACCC TATCAGGCAGT3’) во втором раунде , для амплификации продукта 220 п.о., соответствующего области HCV 5’UTR (Campiotto et al., 2005). Наконец, для подмножества подтипа 2b HCV (см. Результаты) была проведена другая полуположенная реакция ПЦР для амплификации вирусного геномного фрагмента 470 bp, охватывающего конец ядра и начало генов E1, с использованием праймеров E1- Fow (5’GGCGTCGGTGTYAGRGTYCTGG3 ‘), E1-1stRev (5’GGCRGTCCGRTTTATGTGCC3’) и E1-2ndRev (5’ATGACYTTGGCCCACGCTCC3 ‘). Продукты ПЦР анализировали электрофорезом через 1,5% агарозный гель, окрашенный бромидом этидия.

Продукты ПЦР секвенировали с использованием набора Big Dye v.3.1 в генетическом анализаторе ABI 3130XL (как от Life Technologies). Последовательности были отредактированы вручную с помощью SeqMan v7.0 (DNASTAR Inc., Мэдисон, США) и выровнены с BioEdit v.7.02316 вместе с справочными последовательностями HCV из базы данных HCV Национальной лаборатории Лос-Аламоса (http://hcv.lanl.gov). Генотипы определялись с помощью филогенетического вывода с использованием соседнего соединения и двухпараметрического метода Кимуры с 1000 копий бутстрапов в MEGA 5.

Все последовательности ДНК NS5b, полученные в этом исследовании, были депонированы в GenBank и им были присвоены номера [GenBank: JQ711195-JQ711198, KC520829-KC520855]. 5’UTR-последовательности не были депонированы, потому что они короче 200 б.п., что является непременным условием для представления в базу данных GenBank.

Все анализы проводились с использованием STATA® v. 8.0 (Stata Corporation, 2009). Связь времени на диализ в месяцах и инфекцию HCV оценивали по t-критерию Стьюдента. Оценивалась распространенность ВГС и 95% доверительные интервалы (КИ). Был проведен двумерный анализ для расчета коэффициентов распространенности и КИ нескольких факторов и результатов. Для адаптации к потенциальным помехам был проведен многомерный анализ с использованием регрессии Пуассона и коэффициентов распространенности (ОР).

Авторы заявляют, что у них нет конкурирующих интересов.

NMOS и FNG провели все экспериментальные процедуры. RAMS провел статистический анализ. HNS предоставил реагенты и инфраструктуру для экспериментальных процедур. MAS и AMBM задумали и профинансировали исследование. NMOS, FNG и MAS написал рукопись. Все авторы прочитали и утвердили окончательный вариант рукописи.

Мы обязаны медицинскому персоналу обоих центров гемодиализа для обеспечения поддержки пациентов и образцов, проанализированных в этом исследовании. Это исследование финансировалось министерством образования Бразилии (CAPES) через стипендию PhD для FNG; министерство здравоохранения Бразилии через интрамуральные гранты Бразильскому институту рака (INCA); грант Бразильского научного совета (CNPq) № 573806 / 2008-0 (Национальный институт науки и техники по борьбе с раком) и грант штата Научный фонд штата Рио-де-Жанейро (FAPERJ) № E-26 / 102.858 / 2008. Финансирующие агентства поддерживали приобретение материалов и реагентов и не принимали участия в отборе пациентов, анализе результатов или написании этой рукописи.



Источник: rupubmed.com


Добавить комментарий