Гаплоидный геном

Гаплоидный геном

Переезд склада в Европу.
Реализуем препараты от гепатита С в России по закупочной цене - ликвидация склада
Перейти на сайт
Гаплоидный геном

Вопрос, который нередко задают – а зачем это вообще знать? Ну, жил бы человек, не зная, что у него гаплогруппа Н, или N, или I, или R, и такой-то гаплотип, и продолжал бы жить так же. А уж делать ДНК-тесты трижды подряд, продвигаясь каждый раз на ступеньку глубже – зачем все это? Тем более за свои деньги?

Мне такие вопросы задавали многие. Опыт разговоров или переписки с такими людьми показал, что эти вопросы и комментарии бывают или наигранными, порой от непонимания, или, напротив, убежденными. Последние обычно быстро приходят к тому (или начинают с того), что изучение истории вообще не нужно. Глупости всё это. По мнению таких «убежденных», знание истории вообще и своей персональной истории, истории своих предков, никак не сказывается на материальном благосостоянии современников, напротив, тратить на это время совершенно контрпродуктивно. Некоторые подводят под это «научную» базу, что наши гены быстро «размываются» в поколениях, и всего через десяток поколений все становятся одинаковыми, усредненными, и зачем при этом что-то изучать из прошлого?

Результаты ДНК-тестирования мужчин в рамках ДНК-генеалогии сводятся к двум основным показателям. Это – гаплотип и гаплогруппа. Гаплотип – это набор чисел, который является «личным номером ДНК-паспорта» любого мужчины, без исключения. А гаплогруппа, фигурально говоря, это обложка паспорта. Это – не индивидуальная, а групповая характеристика. Гаплогруппа определяет носителя гаплотипа в определенный род, или историческое племя. У любой гаплогруппы, как у любого рода или племени, был один общий предок, патриарх. Поэтому как номер паспорта при наличии обложки является уникальным «определителем» человека, так и гаплотип в совокупности с гаплогруппой являются не менее уникальным определителем человека, при условии, что номер (гаплотип) является достаточно протяженным. Примеры даны ниже в этой книге.

Если у человека такого номера и паспорта нет, то это не мужчина, а женщина. Именно к такому выводу сейчас нередко приходят археологи, которые именно так наиболее надежно определяют пол скелетного остатка в древнем захоронении. Нет в ДНК Y-хромосомы, нет мужского гаплотипа и мужской гаплогруппы – значит, женщина. У последних – свой ДНК-паспорт, под названием «митохондриальная ДНК», который они передают своим детям, как девочкам, так и мальчикам. А отец передает исключительно Y-хромосому, и только, разумеется, сыновьям.

Мало того, что эта «научная база» категорически неверна, но мой опыт показывает, что с последними «дискутантами» дискуссии бесполезны, и через одну-две фразы из подобного рода «убеждений» разговор надо заканчивать. Там ситуация безнадежна, это уже глубинный уровень их мировоззрения. Я не говорю, что мировоззрение у них неправильное, вовсе нет. Оно просто другое, и обсуждать его бесполезно, как и спорить с его носителем.

Напротив, огромное количество людей хотят изучать историю мира, народа, рода, свою родословную. Когда-то я имел отношение к проведению опроса людей, которые прошли тест на ДНК, и узнали свои гаплотип и гаплогруппу. Основной вопрос был такой – изменило ли это вашу жизнь? Из многих десятков людей ни один не ответил, что остался безразличным к результатам тестирования. Все ответили, что в определенной степени (иногда в большой) это их жизнь изменило. Большинство продолжили анализ своей ДНК на более глубоком уровне, и расширили изучение истории мира, своего народа, своей родословной.

У каждого мужчины в Y-хромосоме своя картина мутаций. У близких родственников картина мутаций похожа, потому что они, родственники, сравнительно недавно произошли от одного общего предка, и дополнительные мутации в их Y-хромосомах еще не успели образоваться. Если общий предок жил тысячелетия назад, то картина мутаций у разных потомков разная. Как эту картину отображают?

Отображают картину мутаций в виде так называемых гаплотипов, упомянутых выше как «личный номер паспорта» каждого мужчины, а именно в виде определенных последовательностей чисел, характерных для каждого человека. Чем эта последовательность длиннее, тем уникальнее гаплотип. Например, у автора этих строк гаплотип Y-хромосомы, состоящий из 111 чисел, записывается в следующем виде:

13 24 16 11 11 15 12 12 10 13 11 17 – 16 9 10 11 11 24 14 20 34 15 15 16 16 – 11 11 19 23 15

16 17 21 36 41 12 11 – 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13

11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13

9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11

Это — так называемый 111-маркерный гаплотип. Здесь первое число показывает, что в одном из маркеров, или локусов Y-хромосомы определенная последовательность нуклеотидов (в данном случае квадруплет AGAT, то есть аденин–гуанин–аденин–тимин повторяется 13 раз). В другом маркере, который здесь показан как следующий, блок нуклеотидов (TCTG, то есть тимин–цитозин–тимин–гуанин) повторяется 24 раза, и так далее. У каждого маркера – своя комбинация нуклеотидов.

В академических публикациях по популяционной генетике, впрочем, пока продолжают использовать гаплотипы от 8- до 17-маркерных. В ДНК-генеалогии обычным является использование 67- и 111-маркерных гаплотипов.

В итоге многолетних наблюдений я пришел к выводу, что изучение своей родословной, особенно с привлечением ДНК-генеалогии, безусловно, влияет на наш современный уровень жизни, благосостояние, самооценку, достоинство. Более того, знание и ощущение своего прошлого и прошлого страны, прошлого своего народа каким-то удивительным образом связано с личным миропониманием и мироощущением, и через него – с уровнем личного достоинства и уровнем жизни семьи и всего сообщества.

Откуда получают те числа, которые показаны в гаплотипах? Всё это на самом деле четко определено и зафиксировано. В первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC,

и повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. Этот участок в ДНК и есть локус, он же маркер DYS393. Во втором маркере, под названием DYS390, повторяется уже другая четверка — TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:

TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTA/TCTA/TCTA/TCATCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC.

Перечисленные четыре нуклеотида — это язык ДНК, который состоит из четырех букв при сокращенной записи. Эти нуклеотиды комбинируются парами, их так и называют — «пары оснований». Они фактически держат двойную спираль ДНК. Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.

Приведу свой личный пример. Полтора десятка лет назад я довольно случайно узнал о возможности определить свои гаплогрупп и гаплогруппу. Причем узнал от весьма малоаппетитной личности, с которым имел немало коллизий в сетевых дискуссиях, узнал, когда тот похвалялся, что анализ ДНК показал, что он – «чистый русский». Меня заинтересовало, как ДНК это может показать, и что такое «чистый русский». Как и оказалось, та похвальба была, как обычно у него, пустой. Никакой гаплотип или гаплогруппа не показывают, что некто есть «чистый русский», «чистый украинец», или «чистый еврей». Это вообще «перпендикулярные» понятия, так сказать. Но гаплотип и гаплогруппа показывают род, показывают (в совокупности с другими гаплотипами или гаплогруппами), откуда род ведет свои корни, когда и где (при наличии дополнительных исследований) жили предки рода, пути и времена древних миграций, связь с древними археологическими культурами.

Естественно, чем протяженнее гаплотип, тем выше вероятность того, что в нем произойдет мутация. Мутация в гаплотипах – это результат ошибки в копировании блоков нуклеотидов, тех самых «коротких тандемных повторов», биологической системой копирования ДНК в клетке. Каждый нуклеотид мутирует, то есть копирующая система ошибается при копировании протяженных гаплотипов, со средней вероятностью примерно 0.00178 раз в поколение при протяженности поколения 25 лет, то есть раз в 560 поколений, то есть раз в 14 тысяч лет. Величина поколения в 25 лет в ДНК-генеалогии называется условным поколением, она – сугубо математическая величина. Если кому-то больше нравится брать 30 лет за поколение, то вероятность мутации за 30 лет составит примерно 0.00214, или раз в 468 поколений (по 30 лет), или раз в 14 тысяч лет. Как видим, конечный результат получается точно такой же.

Итак, у любого человека можно выявлять гаплотип с разным разрешением, это будет один и тот же «ДНК-генеалогический паспорт», только разрешение, естественно, тем больше, чем более протяженный гаплотип. Надо сказать, что наука не остановилась на 111-маркерном гаплотипе, и, например, у того же автора определен уже 431-маркерный гаплотип:

13 24 16 11 11 15 12 12 10 13 11 30 16 9 10 11 11 24 14 20 34 15 15 16 16 11 11 19 23 15 16 17 21 36 41 12 11 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 — 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11 — 10 12 15 15 10 10 8 8 9 13 7 8 10 10 13 14 14 15 31 32 11 10 9 9 8 24 8 8 8 16 22 22 24 21 23 14 16 25 28 15 15 6 11 14 15 8 14 11 12 10 11 10 10 11 11 18 10 12 10 7 10 5 8 9 5 5 11 15 8 29 6 7 10 13 11 6 7 7 7 16 10 11 16 22 23 11 12 12 10 7 12 12 13 7 3 20 18 11 11 8 9 13 13 10 11 22 12 16 13 14 11 11 12 10 12 9 13 9 12 11 12 16 7 14 12 10 9 10 4 7 7 13 13 12 11 9 11 10 11 14 8 4 8 6 11 11 16 9 11 13 19 12 12 9 10 9 9 11 11 9 9 14 14 15 9 7 10 12 14 13 14 14 12 6 32 10 11 16 8 7 17 17 11 11 6 13 12 13 11 10 7 13 12 7 – 12 12 7 14 17 17 11 25 8 8 12 8 8 1113 11 12 10 8 13 8 13 14 10 11 9 20 17 15 36 9 13 14 39 33 36 9 10 10 12 18 19 13 9 14 44 10 8 14 9 8 20 11 11 11 11 10 9 9 9 8 8 8 8 9 11 9 23 11 9 16 31 8 20 8 13 12 8 16 10 9 33 27 23 22 10 8 12 10 8 14 8 8 32 55 7 7 5 9 6 11 11 11 13 9 39 33 7 8 27 7 5 13 7 15 28 25 60 42 12 31 22 20 12 3 4

Таких гаплотипов в мире определено пока всего несколько десятков, так что практическая польза от них пока невелика, за исключением нескольких специальных случаев, которые будут пояснены ниже.

Поскольку «коротких тандемных повторов» в Y-хросомоме многие тысячи (выше показано 431 таких повторов, и это только среди 10 миллионов нуклеотидов Y-хромосомы, этот размер определяется методологией исследования; всего же в Y-хромосоме примерно 58 миллионов нуклеотидов, или, точнее, нуклеотидных пар, но не будем здесь вдаваться в излишние подробности). Отсюда можно заключить, что таких «тандемных повторов» в Y-хромосоме может быть примерно 2500, и это, видимо, максимально возможный размер гаплотипа.

Как читатель видит, я не делаю из своего гаплотипа (см. врезку) какой-то секрет, и другим не советую. В нашем мире глобальной информации, где о каждом из нас в сети имеется масса сведений, значительно более потенциально вредоносных, раскрытие гаплотипа вообще никакой опасности не представляет. Гены не имеют к нему никакого отношения, никаких сведений о здоровье или медицинской диагностики там нет, именно потому, что там нет генов. Байки о том, что якобы на гаплотип можно нацелить некое биологическое оружие, не только безосновательны, но и глупы. Такое «биологическое оружие» нацеленное, например, на гаплотип группы R1a, которая есть у половины русских, положило бы почти половину литовцев и латышей, половину украинцев и поляков, треть немцев и шведов с норвежцами, и не менее 20% жителей США и Канады. Поэтому уже сотни тысяч человек, в основном из стран Запада, заносят свои гаплотипы в общедоступные базы данных, и никаких опасений по этому поводу не испытывают.

Гаплотипы выбирают так, чтобы в них маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних академических работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17- и 19-маркерные, затем 25- и 37-маркерные, а сейчас работа рутинно ведется с 67- и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 111-маркерных гаплотипах одна мутация происходит в среднем за 5 поколений, поэтому у 111-маркерных гаплотипов разрешение лучше других. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Протяженные гаплотипы определяют в коммерческих компаниях, обычно персонально, по индивидуальному заказу, и передают в общественные базы данных, если носитель гаплотипа не возражает. Правда, у возражений практически никогда нет оснований, это всегда «нутряное» «как бы чего не вышло». Сейчас в общественных базах данных — сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно.

Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого — войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать когда носители гаплогруппы N были на Урале, когда они появились в Прибалтике, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке — потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, потомки которых увеличивались в числе вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.

Обратимся к гаплогруппам, тем самым «обложкам паспорта», групповым характеристикам. Большое число мутаций и, соответственно, большое временное расстояние между гаплотипами разных гаплогрупп (десятки тысячелетий) вызвано тем, что они относятся к разным родам человека, а относительно умеренное расстояние между двумя гаплотипами одной гаплогруппы (и к тому же одного субклада), часто всего несколько тысяч лет, и вызвано тем, что они фактически родственники, в рамках понятий ДНК-генеалогии. В целом понятия гаплогруппы и субклада часто взаимозаменяемы, и определяются контекстом изложения. И гаплогруппы, и субклады определяются необратимыми мутациями в Y-хромосоме, в отличие от обратимых мутаций в гаплотипах (тех самых повторов, что описаны выше, которые в научной литературе называют STR, от Short Tandem Repeats). Эти необратимые мутации, которые называют снип-мутациями (от сокращения SNP, Single Nucleotide Polymorphism), стараются подобрать такие (для идентификации гаплогрупп и субкладов), которые были бы стабильными за все время существования человечества. Поэтому гаплогруппы и субклады стабильны, не меняются во времени.

Я заказал определение своих гаплотипа и гаплогруппы в соответствующей компании, и вскоре получил ответ. Ответ меня заинтриговал, и я отправился в архивы, военные и региональные, искать своих предков. Пошла обильная информация, о которой я не имел ранее никакого понятия. Оказалось, что мои прямые предки из детей боярских, древнего военно-боевого дворянского сословия, что десятки моих прямых и близких родственников охраняли границы Руси, что мой предок ходил с Петром Первым брать Азов, и оттуда участвовал в Казикерменском походе, о котором я ничего не знал, а сейчас знаю много, и оказалось, что у нас в Курской области есть фамильная деревня, земля для которой была выделена моему прямому предку Ивану Клёсову в 1639 году царским указом за боевую службу.

Я отправился в ту деревню Клёсово, взял у жителей той деревни образцы ДНК, отправил на анализ, и увидел, что это на самом деле мои гаплотип и гаплогруппа, и всего несколько мутаций в гаплотипах показали, что наш общий предок жил в конце 16-го века, о чем и рассказали до того архивы. Дальнейшие исследования, еще более глубокие, показали, что мой гаплотип и субклад, точнее, мои прямые предки, которые его имели – выходцы из восточно­карпатской ветви гаплогруппы R1a, общий предок которой жил в I тыс до н.э., во времена зарождения славянства в том виде, в каком его понимают историки. Но анализ моей Y-хромосомы прошел дальше – мои предки жили в археологической фатьяновской культуре, которая располагалась в центральном европейском регионе современной Российской Федерации примерно 4500-3500 лет назад, и вполне может быть названа древнерусской археологической культурой. В свою очередь ее предки – археологическая культура боевых топоров, начиная примерно с 5200 лет назад. Ископаемые ДНК последней, с археологической датировкой 4600 лет назад – имеют гаплотип, практически такой же, какой у меня. Мои корни, как и корни любого мужчины на планете, описаны в этой книге, в ее разных главах, только я могу примерить всю эту информацию на себя, а те, кто не знают своих гаплотипа-гаплогруппы, не могут. В этом – большая разница в мироощущении между нами.

Я не знаю, какой в итоге будет сформулирована русская (или российская) национальная идея, но то, что она не может быть адекватно сформулирована без учета и без знания истории наших предков, это совершенно определенно. А без знания своих предков патриотизм – просто пустое слово. У него тогда нет основы. То, что хлёстко называют «последним прибежищем негодяя» — это и есть патриотизм без основы. Только эта хлёсткость не про патриотизм, она – про негодяя. Характерная особенность русофобов в том, что они не там в этой фразе ударение ставят. Надо на негодяе, а они – на патриотизме. Впрочем, на то они и русофобы.

Мутации в гаплотипах потомков расходятся от предкового гаплотипа как круги по воде, число мутаций легко рассчитывается, и они подчиняются довольно простым количественным закономерностям. Для кругов на воде, расходящихся от места, куда был брошен камень, легко рассчитать, когда был брошен камень, если знать скорость распространения волны и место нахождения круговой волны в данный момент времени. Чем больше прошло времени – тем дальше круги ушли, тем больше они разошлись. Так и в гаплотипах — чем больше время, прошедшее от общего предка, тем больше мутаций накопилось в гаплотипах его потомков. Число этих мутаций связано с временем, прошедшим от общего предка, с числом гаплотипов в серии, и с константой скорости мутации в гаплотипах, и выражается простой формулой: n/N = kt, где n – число мутаций в серии из N гаплотипов, k – константа скорости мутации (в числе мутаций на гаплотип за условное поколение, равное 25 лет), t – число условных поколений, с табличной поправкой на возвратные мутации.

На многих тысячах примеров показано, что эта формула работает при любом числе гаплотипов и мутаций в них, и при любом времени, прошедшем от общего предка рассматриваемых гаплотипов. Однако при очень больших временах, более 10-20 тысяч лет, и особенно более 100 тысяч лет, нужно использовать гаплотипы с «медленными» маркерами, то есть с малыми константами скоростей мутаций, и тем самым снижать число мутаций и число возвратных мутаций. По аналогии, вряд ли целесообразно изучать скорости радиоактивного распада элементов со временами полураспада в тысячелетия, используя секундомер. Или пытаться изучать круги на воде за километры от места, куда был брошен камень, для этого нужно значительно более мощное воздействие. Как всегда, нужен конкретный анализ в конкретной ситуации, единых подходов на все случае жизни не бывает. Варианты конкретного анализа в конкретных ситуациях и рассматривает ДНК-генеалогия.

Мутации в ДНК-генеалогии – это не только единичные необратимые мутации-снипы, описанные выше, которые определяют гаплогруппы и субклады, но и обратимые мутации, меняющие числа повторов, или аллели, в гаплотипах. В русскоязычной литературе их называют просто «мутации», с пониманием, что это не те мутации (в генах), которые обычно возникают под действием радиации. Переход числа повторов в маркере Y-хромосомы от 25 к 24 или 26 (или наоборот) имеет совершенно другую природу, чем «поломка» гена. Такой переход является следствием спонтанной, случайной ошибки ДНК-копирующей «биологической машины», это процесс первого порядка с точки зрения физико-химической или биологической кинетики, он не зависит от внешних воздействий.

Что важно отметить — в большинстве случаев результаты расчетов почти не зависят от размера выборки (при числе гаплотипов больше двух-трех десятков), то есть они достаточно устойчивы к статистическим вариациям. Размер выборки увеличивает точность, и то только до определенных пределов. Это относится к довольно большим популяциям, которые перемешались за тысячелетия, но именно с такими обычно и работают.

А.А. Клёсов



Источник: zen.yandex.ru


Добавить комментарий